View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6294_low_30 (Length: 226)

Name: NF6294_low_30
Description: NF6294
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6294_low_30
NF6294_low_30
[»] chr2 (2 HSPs)
chr2 (130-200)||(637977-638047)
chr2 (18-99)||(637870-637948)


Alignment Details
Target: chr2 (Bit Score: 63; Significance: 2e-27; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 130 - 200
Target Start/End: Original strand, 637977 - 638047
Alignment:
130 atcataagctcgtttcttttattacaaatgaatctaatcggcgttgagaggatgattatactctaaagtct 200  Q
    |||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
637977 atcataagctcgttacttttattacaaatgaatctagtcggcgttgagaggatgattatactctaaagtct 638047  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 18 - 99
Target Start/End: Original strand, 637870 - 637948
Alignment:
18 atagcaaggtaaatagtactactaatcaaccaatttcannnnnnnnaatggggtcacatagcaacattcgttactaatcgtc 99  Q
    |||||||||||||||||||||   ||||||||||||||        ||||||||||||||||||||||||||||||||||||    
637870 atagcaaggtaaatagtacta---atcaaccaatttcattttttttaatggggtcacatagcaacattcgttactaatcgtc 637948  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University