View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6294_low_30 (Length: 226)
Name: NF6294_low_30
Description: NF6294
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6294_low_30 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 63; Significance: 2e-27; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 130 - 200
Target Start/End: Original strand, 637977 - 638047
Alignment:
| Q |
130 |
atcataagctcgtttcttttattacaaatgaatctaatcggcgttgagaggatgattatactctaaagtct |
200 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
637977 |
atcataagctcgttacttttattacaaatgaatctagtcggcgttgagaggatgattatactctaaagtct |
638047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 18 - 99
Target Start/End: Original strand, 637870 - 637948
Alignment:
| Q |
18 |
atagcaaggtaaatagtactactaatcaaccaatttcannnnnnnnaatggggtcacatagcaacattcgttactaatcgtc |
99 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
637870 |
atagcaaggtaaatagtacta---atcaaccaatttcattttttttaatggggtcacatagcaacattcgttactaatcgtc |
637948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University