View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6294_low_31 (Length: 210)
Name: NF6294_low_31
Description: NF6294
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6294_low_31 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 30 - 194
Target Start/End: Complemental strand, 49086045 - 49085877
Alignment:
| Q |
30 |
ggcacagaaataatgtaagaacggacgaaatcattcctgcaaatgcaattcttccagctaaaagcaggatcttggcctcatcgttattagacataagcat |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
49086045 |
ggcacagaaataatgtaagaacggacgaaatcattcctgcaaatgcaattcttccagctaaaagcaggatcttggcttcatcgttattagacataagcat |
49085946 |
T |
|
| Q |
130 |
actagttaaaccacagccctaacaagtaagatt----tacacgaggtacaataaaaaattcaaatcaat |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||| |
|
|
| T |
49085945 |
gctagttaaaccacagccctaacaagtaagatttaaataaacgaggtacaataaaaaattcaaatcaat |
49085877 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University