View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6295_high_18 (Length: 303)
Name: NF6295_high_18
Description: NF6295
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6295_high_18 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 262; Significance: 1e-146; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 1 - 281
Target Start/End: Complemental strand, 42850460 - 42850179
Alignment:
| Q |
1 |
tagaagcgacacacaatggttgattcacagattcgcataacaacttgtcgatgtttgtgctagtcttgtggaattatatgtgtttggtgttatttgtttg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42850460 |
tagaagcgacacacaatggttgattcacagattcgcataacaacttgtcgatgtttgtgctagtcttgtggaattatatgtgtttggtgttatttgtttg |
42850361 |
T |
 |
| Q |
101 |
tgataggtttttt-gacaatgggttcagtcttcttgtgagagggcttattataaatagtgattcttatgtcatgtgtgatcactaattcatggtagtaat |
199 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42850360 |
tgataggtttttttgacaatgggttcagtcttcttgtgaaagggcttattataaatagtgattcttatgtcatgtgtgatcactaattcatggtagtaat |
42850261 |
T |
 |
| Q |
200 |
ccaattgaagtgctattagtgttccaattttccccccttttttgctctttgtattgttatctctttgagtgatgatgtgggt |
281 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
42850260 |
ccaattgaagtgctattagtgttccaattttcccccctgttttgctctttgtattgttatctctttgagcgatgatgtgggt |
42850179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 51 - 274
Target Start/End: Original strand, 30941513 - 30941734
Alignment:
| Q |
51 |
atgtttgtgctagtcttgtggaattatatgtgtttggtgttatttgtttgtgataggttttttgacaatgggttcagtcttcttgtgagagggcttatta |
150 |
Q |
| |
|
|||||| ||||||||| | ||||||||| ||||||||||||||| |||||||||||||||| |||| |||||||||||||| ||||| ||| | | ||| |
|
|
| T |
30941513 |
atgtttttgctagtctggcggaattataggtgtttggtgttattggtttgtgataggtttt--gacattgggttcagtcttcctgtgaaaggacatttta |
30941610 |
T |
 |
| Q |
151 |
taaatagtgattctt-atgtcatgtgtgatcactaattcatggtagtaatccaattgaagtgctattagtgttccaattttccccccttttttgctcttt |
249 |
Q |
| |
|
||||||||| |||| |||||||| |||||||||| ||| ||||| ||||||||||| ||||||||| ||||||||| ||| ||||||||||||| ||| |
|
|
| T |
30941611 |
caaatagtgactctttatgtcatgagtgatcactacttcgtggtattaatccaattgcagtgctattggtgttccaaattt-tccccttttttgctattt |
30941709 |
T |
 |
| Q |
250 |
gtattgttatctctttgagtgatga |
274 |
Q |
| |
|
|||| ||||||||||||| |||||| |
|
|
| T |
30941710 |
gtatggttatctctttgactgatga |
30941734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University