View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6295_high_27 (Length: 260)
Name: NF6295_high_27
Description: NF6295
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6295_high_27 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 154; Significance: 9e-82; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 154; E-Value: 9e-82
Query Start/End: Original strand, 56 - 241
Target Start/End: Original strand, 33262054 - 33262239
Alignment:
| Q |
56 |
ttgcaaccacagagtgccatgttggaagggccagcaattagtcatctgcaaccacaaactgccatattggaggggtcaacaatgactagtttgcaaccgc |
155 |
Q |
| |
|
|||| |||||||| ||||||||||||||||||| |||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33262054 |
ttgctaccacagactgccatgttggaagggccatcaattagtaatctgcaaccacgaactgccatattggaggggtcaacaatgactagtttgcaaccgc |
33262153 |
T |
 |
| Q |
156 |
agaatgccacattgcaagggccagcaagtctgcctttcaacatcccaacttcagaagagctgagctcaatgattttgggtcattca |
241 |
Q |
| |
|
||||||||||| ||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33262154 |
agaatgccacactgcaagggccaacaagtctgcctttcaacatcccaatttcagaagagctgagctcaatgattttgggtcattca |
33262239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 18 - 72
Target Start/End: Original strand, 33261971 - 33262025
Alignment:
| Q |
18 |
cacagagagcgatattgcaagggccagcgatgactgagttgcaaccacagagtgc |
72 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
33261971 |
cacagagagcgatattgcaagggccagcgatgactgagttggaaccacagagtgc |
33262025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University