View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6295_high_29 (Length: 254)
Name: NF6295_high_29
Description: NF6295
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6295_high_29 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 1 - 237
Target Start/End: Complemental strand, 33205681 - 33205449
Alignment:
| Q |
1 |
attattcttgtagtgacggttggccttctaatttcatactaccaaggttgaaagtcacagttttttagtgcaaaatccaggcataccactacccatcttg |
100 |
Q |
| |
|
||||||||| |||||||||||||||||| ||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33205681 |
attattcttatagtgacggttggccttcgaatttcatattatcaaggttgaaagtcacagttttttagtgcaaaatccaggcataccactacccatcttg |
33205582 |
T |
 |
| Q |
101 |
tctatagtttgtgcacattgcaataccaattcttaccnnnnnnnnnnctttccctttcacgggaaagtctctattcaaacgtgcatgcaaaaccaattgg |
200 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
33205581 |
tctctagtttgtgcacattgcaataccaattcttaccttttttttt--tttccctttcacgggaaag--tctattcaaacgtgcatgcaaaaccaattgg |
33205486 |
T |
 |
| Q |
201 |
attcaaacttgtcatctagtagtactatgtagtggat |
237 |
Q |
| |
|
||||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
33205485 |
attcaaagttgtcatctggtagtactatgtagtggat |
33205449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University