View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6295_high_32 (Length: 252)
Name: NF6295_high_32
Description: NF6295
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6295_high_32 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 10 - 252
Target Start/End: Complemental strand, 43483930 - 43483688
Alignment:
| Q |
10 |
agcaaaggagaacaaaaatcacttgtagaatgcgtttgttttgtgaagcaaccatcttaaaagttaaaagcaatttagacttgtgtagtatatgatttgc |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43483930 |
agcaaaggagaacaaaaatcacttgtagaatgcgtttgttttgtgaagcaaccatcttaaaagttaaaagcaatttagacttgtgtagtatatgatttgc |
43483831 |
T |
 |
| Q |
110 |
tctttttctgaatataccatatggatatgttaatttaggtcctatatatagacacattttggcagtttctagctacctaagttaactgtcatgaattatt |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43483830 |
tctttttctgaatataccatatggatatgttaatttaggtcctatatatagacacattttggcagtttctagctacctaagttaactgtcatgaattatt |
43483731 |
T |
 |
| Q |
210 |
gggtccgtatattaatagatcatggtggtaaattgtatatgac |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43483730 |
gggtccgtatattaatagatcatggtggtaaattgtatatgac |
43483688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University