View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6295_high_39 (Length: 247)
Name: NF6295_high_39
Description: NF6295
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6295_high_39 |
 |  |
|
| [»] scaffold0276 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0276 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: scaffold0276
Description:
Target: scaffold0276; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 18 - 237
Target Start/End: Complemental strand, 5957 - 5740
Alignment:
| Q |
18 |
atatgcccagattatgttcaaattacatcaacagacaactatttatcacaaactatgttcaaaatacgtcaatagacaactatttaacacnnnnnnnnnn |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
5957 |
atatgcccagattatgttcaaattacatcaacagacaactatttatcacaaactatgttcaaaatacgtcaatagacaactat--aacacaaaaaacaaa |
5860 |
T |
 |
| Q |
118 |
nnnnnnnnncttccatagaagcaaaaatgacatatcctgcaccagcattgaaaccggaagtagacaaacacccaaatcatcaaatgtttcaatatcaact |
217 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5859 |
aacaaaaaacttccatagaagcaaaaatgatatatcctgcaccagcattgaaaccggaagtagacaaacacccaaatcatcaaatgtttcaatatcaact |
5760 |
T |
 |
| Q |
218 |
taattaattgaaaacctatg |
237 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
5759 |
taattaattgaaaacctatg |
5740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University