View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6295_low_21 (Length: 291)
Name: NF6295_low_21
Description: NF6295
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6295_low_21 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 16 - 279
Target Start/End: Original strand, 33235036 - 33235299
Alignment:
| Q |
16 |
acaaaggccaaagtaatttatttcttgaattataagagcaagctagcatatcattgtgaaggaaagaaagaagaagtagaaaaatgggggtacaaggtac |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33235036 |
acaaaggccaaagtaatttatttcttgaattataagagcaagctagcatatcattgtgaaggaaagaaagaagaagtagaaaaatgggggtacaaggtac |
33235135 |
T |
|
| Q |
116 |
tttagaatacttgtctgatttactcagtagcacnnnnnnnnnnnngaagaagcaaactcagactgtatctcttaaaatcagaatggactgtgaaggttgt |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33235136 |
tttagaatacttgtctgatttactcagtagcacaaaaaagaaaaagaagaagcaaactcaaactgtatctcttaaaatcagaatggactgtgaaggttgt |
33235235 |
T |
|
| Q |
216 |
gctcgcaaggttaagcatgttctttctggtgttaaaggtactttttcttttcttctatgcttca |
279 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33235236 |
gctcgcaaggttaagcatgttctttctggtgttaaaggtactttttcttttcttctatgcttca |
33235299 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University