View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6295_low_25 (Length: 282)
Name: NF6295_low_25
Description: NF6295
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6295_low_25 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 183; Significance: 5e-99; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 183; E-Value: 5e-99
Query Start/End: Original strand, 14 - 267
Target Start/End: Complemental strand, 43483208 - 43482970
Alignment:
| Q |
14 |
cataggttaaaaattagttattggatcaaaatctttggtctgacaaactcatttattttctttaaacttaattgtatgattggattgactctaaactcgt |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
43483208 |
cataggttaaaaattagttattggatcaaaatctttggtctgacaaactcatttattttctttaaacttaactgtatgattggattgactctaaactcgt |
43483109 |
T |
 |
| Q |
114 |
cagaatcacagccagccacatgattttagtaaaaactacattttagatcgaacttcaacaaattcacagcatcaccgtaattttatcgaatacattattc |
213 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
43483108 |
cagaatcacagccagccacatgattttagcaaaaactacatttta----aaacttcaacaaattcacagcatccccgtaattttatcgaatacattattc |
43483013 |
T |
 |
| Q |
214 |
atcaaacacacactaaatccatgcaactttcaataactaaaaccgggtgaaaat |
267 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43483012 |
atc-----------aaatccatgcaactttcaataactaaaaccgggtgaaaat |
43482970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University