View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6295_low_28 (Length: 257)
Name: NF6295_low_28
Description: NF6295
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6295_low_28 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 164; Significance: 9e-88; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 164; E-Value: 9e-88
Query Start/End: Original strand, 1 - 234
Target Start/End: Complemental strand, 51761612 - 51761384
Alignment:
| Q |
1 |
atgaagaaagcaaggagtgtgagggagttatgtgtttgcatcattttttgtttatatcacaaagaaaagaagaacaaaaggattaagaaattagaggaan |
100 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51761612 |
atgaagaaagcatggagtgtgagggagttatgtgtttgcatcattttttgtttatatcacaaagaaaagaagaacaaaaggattaagaaattagaggaat |
51761513 |
T |
|
| Q |
101 |
nnnnnnnnnnnnnnnnnntaagagtgagtgtgattgagtagagtaaggggagatggcttttatttatagggaagggaaatgttggtgcctttggaatgga |
200 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51761512 |
gttgtgttgtgtt-----taagagtgagtgtgattcagtagagtaaggggagatggcttttatttatagggaagggaaatgttggtgcctttggaatgga |
51761418 |
T |
|
| Q |
201 |
agtgagtcaagatctctaagtcatatttaatatt |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
51761417 |
agtgagtcaagatctctaagtcatatttaatatt |
51761384 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University