View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6295_low_35 (Length: 250)
Name: NF6295_low_35
Description: NF6295
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6295_low_35 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 240
Target Start/End: Complemental strand, 52238827 - 52238590
Alignment:
| Q |
1 |
ctcttgttgatataattgaagggaatgcggttaaaagatcttatcaaagagctttactcagtctgcatccagataagttgcagcaaaagggtgctacttc |
100 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
52238827 |
ctcttgttgatataattgaagggaacgcggttaaaagatcttatcaaagagctttactcagtctgcatccggataagttgcagcaaaagggtgctacttc |
52238728 |
T |
|
| Q |
101 |
agaccaaaagtacactgcagaaaaagtttttgatattttacaggtactatgtttgggtcaatttattagcattacaaaaagtttgtctctttcataggca |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
52238727 |
agaccaaaagtacactgcagaaaaagtttttgatattttgcaggtactatgtttgggtcaatttattagcattacaaaaag--tgtctctttcataggca |
52238630 |
T |
|
| Q |
201 |
atttctagaatcttgcttgaaattggtcataaacattcat |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52238629 |
atttctagaatcttgcttgaaattggtcataaacattcat |
52238590 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University