View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6295_low_39 (Length: 247)

Name: NF6295_low_39
Description: NF6295
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6295_low_39
NF6295_low_39
[»] scaffold0276 (1 HSPs)
scaffold0276 (18-237)||(5740-5957)


Alignment Details
Target: scaffold0276 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: scaffold0276
Description:

Target: scaffold0276; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 18 - 237
Target Start/End: Complemental strand, 5957 - 5740
Alignment:
18 atatgcccagattatgttcaaattacatcaacagacaactatttatcacaaactatgttcaaaatacgtcaatagacaactatttaacacnnnnnnnnnn 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  |||||              
5957 atatgcccagattatgttcaaattacatcaacagacaactatttatcacaaactatgttcaaaatacgtcaatagacaactat--aacacaaaaaacaaa 5860  T
118 nnnnnnnnncttccatagaagcaaaaatgacatatcctgcaccagcattgaaaccggaagtagacaaacacccaaatcatcaaatgtttcaatatcaact 217  Q
             ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5859 aacaaaaaacttccatagaagcaaaaatgatatatcctgcaccagcattgaaaccggaagtagacaaacacccaaatcatcaaatgtttcaatatcaact 5760  T
218 taattaattgaaaacctatg 237  Q
    ||||||||||||||||||||    
5759 taattaattgaaaacctatg 5740  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University