View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6295_low_41 (Length: 239)

Name: NF6295_low_41
Description: NF6295
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6295_low_41
NF6295_low_41
[»] chr7 (1 HSPs)
chr7 (18-183)||(27776281-27776446)


Alignment Details
Target: chr7 (Bit Score: 122; Significance: 1e-62; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 18 - 183
Target Start/End: Complemental strand, 27776446 - 27776281
Alignment:
18 catggtgccccaaatactagttatgtcttgttggccattgggaaggtttatgggaatgggtttaaagaggcgcacaacacagaagtannnnnnnnatttc 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||| |||||        |||||    
27776446 catggtgccccaaatactagttatgtcttgttggccattgggaaggtttatgggaatgggtttaaagaggcacataacacacaagtattttttttatttc 27776347  T
118 actatctatattttctttaattgcctcttaatgataattttacagtaactcaccttgtttaatata 183  Q
    ||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||    
27776346 actatctttattttctttaattgcctcttaatgataattttacaataactcaccttgtttaatata 27776281  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University