View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6295_low_43 (Length: 239)
Name: NF6295_low_43
Description: NF6295
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6295_low_43 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 17 - 239
Target Start/End: Original strand, 42079500 - 42079722
Alignment:
| Q |
17 |
accctttacttctcatgttactttttcttcnnnnnnncctttctaaatagtttagtgggttaattcacatcttaccgtgaataattgggaagttcaaagt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||| ||||| |
|
|
| T |
42079500 |
accctttacttctcatgttactttttcttctttttttcctttctaaatagtttagtgggttaattcacatcttatcgtgaataagtgggaagtttaaagt |
42079599 |
T |
|
| Q |
117 |
ttgaacacatgtctcagtgtatattttacaattatctataccaactgagttaaattcggcacacgtctctcgttatttcattctagtaaaatcattgact |
216 |
Q |
| |
|
|||||||| |||||| || |||||||| ||||||||| || ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42079600 |
ttgaacacctgtctcggtatatattttgcaattatctctatcaactgagttaaattcgacacacgtctctcgttatttcattctagtaaaatcattgact |
42079699 |
T |
|
| Q |
217 |
tgatcagaaattaaaagcatatt |
239 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
42079700 |
tgatcagaaattaaaagcatatt |
42079722 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University