View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6295_low_44 (Length: 226)
Name: NF6295_low_44
Description: NF6295
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6295_low_44 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 107; Significance: 9e-54; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 107; E-Value: 9e-54
Query Start/End: Original strand, 26 - 168
Target Start/End: Complemental strand, 38128184 - 38128042
Alignment:
| Q |
26 |
ccaaactgtgggagaataagttgattactgcggccaacgtcctattggcggcaaaagactatttgcacgagtggctattattacaacaaacggcccctaa |
125 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||| ||||| ||| | |||||||| ||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
38128184 |
ccaaactgtgggagaataagttgattactgcagccaatgtcctcttgacagcaaaagattatttgcacgagtggctattattacaacagacggcccctaa |
38128085 |
T |
 |
| Q |
126 |
tcaacctcaacatgccgcagaacacagatggttgaaaccccct |
168 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||| ||||| |
|
|
| T |
38128084 |
tcaacctcaacataccgcagaacacagatggttgaaaacccct |
38128042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University