View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6295_low_8 (Length: 430)
Name: NF6295_low_8
Description: NF6295
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6295_low_8 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 394; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 394; E-Value: 0
Query Start/End: Original strand, 15 - 412
Target Start/End: Original strand, 32169236 - 32169633
Alignment:
| Q |
15 |
cacagacacagcgagtacgattcgtgttccttcttccgccacagatagcctcaatctcacgcttctccaactcaaatgattatgagattcaaataggtgt |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32169236 |
cacagacacagcgagtacgattcgtgttccttcttccgccacagatagcctcaatctcacgcttctccaactcaaatgattatgagattcaaataggtgt |
32169335 |
T |
 |
| Q |
115 |
tctgtgtttggtgctttcacccttcaacaatggcattgctagctccacaacgcacgtgcctcatcttcactctcttcaccgttttcttactttcatcttc |
214 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32169336 |
tctgtgtttggtgttttcacccttcaacaatggcattgctagctccacaacgcacgtgcctcatcttcactctcttcaccgttttcttactttcatcttc |
32169435 |
T |
 |
| Q |
215 |
tttaagctcagcaacacccaccacagcttgcaaattcagttttcgcgacggaaacaagctttacaattataccctctcttctccaattcgtaacttccct |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32169436 |
tttaagctcagcaacacccaccacagcttgcaaattcagttttcgcgacggaaacaagctttacaattataccctctcttctccaattcgtaacttccct |
32169535 |
T |
 |
| Q |
315 |
catggcattctcagcgaagacgggtcctctctctctccctcactttctgatctgatatgatatcgttattattcatcgattcaagtatagaaacattt |
412 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32169536 |
catggcattctcagcgaagacgggtcctctctctctccctcactttctgatctgatatgatatcgttattattcatcgattcaagtatagaaacattt |
32169633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University