View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6296_high_14 (Length: 221)
Name: NF6296_high_14
Description: NF6296
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6296_high_14 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 19 - 204
Target Start/End: Complemental strand, 34488754 - 34488569
Alignment:
| Q |
19 |
agaagaccaacaccatttttgtatgctattctttttatgtcacgttggaacgatttatgctcctaatatttgtattaagtacgtagtattaatttttaca |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
34488754 |
agaagaccaacaccatttttgtatgctattctttttatgtcacgttggaacgatttatgctccaaatatttgtattaagtacgtagtattaatttttaca |
34488655 |
T |
 |
| Q |
119 |
ttatcaataatttatcagctgtgttttgtttgctccacaattctgtcggtgagccggttaatgacgggcttgtttgttgtatgctt |
204 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
34488654 |
ttatcaataatttatcagccgtgttttgtttgctccacaattccgtcggtgagccggttaatgacgggcttgttcgttgtatgctt |
34488569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University