View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6296_high_5 (Length: 440)
Name: NF6296_high_5
Description: NF6296
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6296_high_5 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 81; Significance: 6e-38; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 81; E-Value: 6e-38
Query Start/End: Original strand, 326 - 426
Target Start/End: Complemental strand, 14124637 - 14124537
Alignment:
| Q |
326 |
ttaccaagagataagacaaacatgaatgattatagaaagctcaggaaacttaccatgacagcaagaggtgagccatacataagaatgttcaaagctgcac |
425 |
Q |
| |
|
|||| |||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14124637 |
ttacaaagagataagacaaacatgaataattatagaaagcttcagaaacttaccatgacagcaagaggtgagccatacataagaatgttcaaagctgcac |
14124538 |
T |
 |
| Q |
426 |
c |
426 |
Q |
| |
|
| |
|
|
| T |
14124537 |
c |
14124537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 207 - 297
Target Start/End: Complemental strand, 14124960 - 14124870
Alignment:
| Q |
207 |
acatgacctttcaagcatctctatagacattgaagaagatttaaggagccagaaattggatgtccaacatatttgccacagaaatttagaa |
297 |
Q |
| |
|
||||||||||||||| ||||||||||||| | |||||||||||||||||| |||||||| |||||| ||||||||||||| |||||||||| |
|
|
| T |
14124960 |
acatgacctttcaagtatctctatagacactcaagaagatttaaggagcctgaaattggttgtccatcatatttgccacaaaaatttagaa |
14124870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University