View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6296_low_13 (Length: 233)
Name: NF6296_low_13
Description: NF6296
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6296_low_13 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 140; Significance: 2e-73; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 19 - 215
Target Start/End: Complemental strand, 27958929 - 27958735
Alignment:
| Q |
19 |
cttgtgttgaatggaaggtgtcttagcagccacgagtaaatannnnnnnngagtcattttgatctttgaatgtgtctaacactgttactatagtaattaa |
118 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||| ||| ||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
27958929 |
cttgtgttgaatggaaggtgccttagcagccacgagtatatattttta--gagtcattttgatctttgaatgtatctaacactgttactatagtaattaa |
27958832 |
T |
|
| Q |
119 |
atttatcaaaactacagtaacattccaaatgcaactttctttaatgagtttagacctcgaatgtgtcctttaataagtttggccggtcctccaatat |
215 |
Q |
| |
|
||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||| |
|
|
| T |
27958831 |
atttatcaaaattacagtaacattctaaatgcaactttctttaatgagtttagacctcgaatgtgtcttttaatgagtttggccggtcctccaatat |
27958735 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 19 - 56
Target Start/End: Complemental strand, 27955714 - 27955677
Alignment:
| Q |
19 |
cttgtgttgaatggaaggtgtcttagcagccacgagta |
56 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| |||| |
|
|
| T |
27955714 |
cttgtgttgaatggaaggtgtcttaacagccaccagta |
27955677 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 66; Significance: 3e-29; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 146 - 215
Target Start/End: Original strand, 16330837 - 16330906
Alignment:
| Q |
146 |
aatgcaactttctttaatgagtttagacctcgaatgtgtcctttaataagtttggccggtcctccaatat |
215 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16330837 |
aatgcaactttctttaatgagtttagaccgcgaatgtgtcctttaataagtttggccggtcctccaatat |
16330906 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University