View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6296_low_14 (Length: 221)

Name: NF6296_low_14
Description: NF6296
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6296_low_14
NF6296_low_14
[»] chr6 (1 HSPs)
chr6 (19-204)||(34488569-34488754)


Alignment Details
Target: chr6 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 19 - 204
Target Start/End: Complemental strand, 34488754 - 34488569
Alignment:
19 agaagaccaacaccatttttgtatgctattctttttatgtcacgttggaacgatttatgctcctaatatttgtattaagtacgtagtattaatttttaca 118  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||    
34488754 agaagaccaacaccatttttgtatgctattctttttatgtcacgttggaacgatttatgctccaaatatttgtattaagtacgtagtattaatttttaca 34488655  T
119 ttatcaataatttatcagctgtgttttgtttgctccacaattctgtcggtgagccggttaatgacgggcttgtttgttgtatgctt 204  Q
    ||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||    
34488654 ttatcaataatttatcagccgtgttttgtttgctccacaattccgtcggtgagccggttaatgacgggcttgttcgttgtatgctt 34488569  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University