View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6296_low_16 (Length: 201)
Name: NF6296_low_16
Description: NF6296
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6296_low_16 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 113; Significance: 2e-57; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 23 - 184
Target Start/End: Complemental strand, 28463739 - 28463576
Alignment:
| Q |
23 |
aaagttacta--atgattcacgtgcttcaaaagcttatgtttatttgtgcttaaaattcctcatcgtaagaggaaataggtttatgagaaagagaaacat |
120 |
Q |
| |
|
|||||||||| ||||||||| ||||| ||||| ||||| |||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
28463739 |
aaagttactactatgattcacctgcttaaaaagtttatgcttatttgtgcttcaaattcctcatcgtaaggggaaataggtttatgagaaagagaaacat |
28463640 |
T |
 |
| Q |
121 |
gttatgttcatgaatctcgaagtaagaaaattcgtccaaaaagaacatcatttaaaaacattat |
184 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||| | |||| |||||||||||||||||||| |
|
|
| T |
28463639 |
gttatgttcatgaatctcgaagtaagaaaactcgtctataaagtacatcatttaaaaacattat |
28463576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University