View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6297_high_10 (Length: 251)
Name: NF6297_high_10
Description: NF6297
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6297_high_10 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 1 - 244
Target Start/End: Complemental strand, 36819748 - 36819505
Alignment:
| Q |
1 |
tcattcaaattaattaaagccagtcctgtaagaatttcttgatggctttgtcataatctcatttctcaataatcattatcatgtaatgctctttattaat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
36819748 |
tcattcaaattaattaaagccagtcctgtaagaatttcttgatggctttgtcataatctcatttctcaataattattatcatgtaatgctctttattaat |
36819649 |
T |
|
| Q |
101 |
atggattaatgcatttttaagttaatcgtacagacacaggcattagatgatgtnnnnnnnnttcataatttattgccctatatatgtatgattgaaataa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36819648 |
atggattaatgcatttttaagttaatcgtacagacacaggcattagatgatgtaaaaagaattcataatttattgccctatatatgtatgattgaaataa |
36819549 |
T |
|
| Q |
201 |
ataaaatggctattgttttcagatacttggtttcttctgtgctg |
244 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36819548 |
atataatggctattgttttcagatacttggtttcttctgtgctg |
36819505 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University