View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6297_low_13 (Length: 249)
Name: NF6297_low_13
Description: NF6297
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6297_low_13 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 117; Significance: 1e-59; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 23 - 236
Target Start/End: Complemental strand, 7264108 - 7263886
Alignment:
| Q |
23 |
catttgtctcaatatttttcaacaaaatatagaaatatttacttgaaattcgtttacttaataacttaaaaatttatcctttacnnnnnnnnnn------ |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7264108 |
catttgtctcaatatttttcaacaaaatatagaaatattttcttgaaattcgtttacttaataacttaaaaatttatcctttacaaaaaaaaaaaaaaaa |
7264009 |
T |
|
| Q |
117 |
----cttaaaaatttatcgtttca-gcacaaatcttatcatttcattcgattttacctttttaatttgtgctcttagcatgattcatagaataattacgt |
211 |
Q |
| |
|
|||||||||||||||||||| | ||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
7264008 |
aaaacttaaaaatttatcgtttcaagtgcaaattttatcatttcattcgattttacctttttaatttgtgctcttagcacgattcatagaataattacgt |
7263909 |
T |
|
| Q |
212 |
taagagtctttttcttcttctcact |
236 |
Q |
| |
|
|| ||||||||||||| ||||||| |
|
|
| T |
7263908 |
ta--agtctttttcttcctctcact |
7263886 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University