View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6297_low_14 (Length: 239)
Name: NF6297_low_14
Description: NF6297
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6297_low_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 166; Significance: 6e-89; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 36820090 - 36820312
Alignment:
| Q |
1 |
tatattcaaaacaagcaaccaataatacaattttaagagagggaaaccaataaaatgtttcactaaaactaataattttaacacttnnnnnnnntctaca |
100 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
36820090 |
tatattcaaaacaagcaaccaacaatacaattttaagagagggaaaccaataaaatatttcattaaaactaataattttaacacttaaaaaaaatctaca |
36820189 |
T |
 |
| Q |
101 |
aatagagatacaatttgttgacactgtacagaccaatactttttagtcnnnnnnncaattgtgccgtgtgctgcagtttacaaatagacataaactttat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36820190 |
aatagagatacaatttgttgacactgtacagaccaatactttttagtcaaaaaaacaattgtgccgtgtgctgcagtttacaaatagacataaactttat |
36820289 |
T |
 |
| Q |
201 |
tacatggctaacacaattgagat |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
36820290 |
tacatggctaacacaattgagat |
36820312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University