View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6298_high_2 (Length: 583)
Name: NF6298_high_2
Description: NF6298
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6298_high_2 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 485; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 485; E-Value: 0
Query Start/End: Original strand, 19 - 546
Target Start/End: Complemental strand, 37745367 - 37744839
Alignment:
| Q |
19 |
tagactgcaaactataacacatccctctagtccccatagaaatagcatcactaacaccaatagtgttaaacctaaacggaatcataccggcttcggcgac |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37745367 |
tagactgcaaactataacacatccctctagtccccatagaaatagcatcactaacaccaatagtgttaaacctaaacggaatcataccggcttcggcgac |
37745268 |
T |
|
| Q |
119 |
gccttctttaacagcttcggagagatgaaggagatgcatattgcaggtgtttccttcgtaccagacggaggaaacaccgacttgtggcttttttaagtcg |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37745267 |
gccttctttaacagcttcggagagatgaaggagatgcatattgcaggtgtttccttcataccagacggaggaaacaccgacttgtggcttttttaagtcg |
37745168 |
T |
|
| Q |
219 |
gcatcggagagaccgacaccgtagaggattgcttgtgatgcgccttgggattttggttcggtgattcgggagctgtatttgttgagttttgtgggttcat |
318 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||| |
|
|
| T |
37745167 |
gcatcggagagaccgacaccgtagaggattgcttgtgatgcgccttgggattttggttcggtgattcgggaactgtatttgttaagttttgtgggttcaa |
37745068 |
T |
|
| Q |
319 |
tggaaggggtattggtggagatggaggattttacggatatgcgccgagagggagtgggggtgtgagtaggaaagagggcgttgtaggttggggaaaagag |
418 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
37745067 |
tggaagggggattggtggagatggaggattttacggatatgcgccgagagggagtgggggtgtgagtaggaaagagggcggtgtaggttggggaaaagag |
37744968 |
T |
|
| Q |
419 |
agttgactgcattgttacggcggaggagtgtggaatggtgagggttttggagtgggcgcgg-aaatgggtttaggaatgagtagtaagggagtgttgtag |
517 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||| |||||||||| ||||||||||| |
|
|
| T |
37744967 |
agttgactgcattgttacggcggaggagtgtggaatggagagggttttggagtgggcgcggaaaatgggtttaggaaggagtagtaagtgagtgttgtag |
37744868 |
T |
|
| Q |
518 |
gaaggagagtgactaatttctcatatcgc |
546 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
37744867 |
gaaggagagtgactaatttctcatatcgc |
37744839 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University