View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6298_high_26 (Length: 219)
Name: NF6298_high_26
Description: NF6298
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6298_high_26 |
 |  |
|
| [»] scaffold0027 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0027 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: scaffold0027
Description:
Target: scaffold0027; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 217
Target Start/End: Complemental strand, 63049 - 62833
Alignment:
| Q |
1 |
acatcctctcaagacatgttataaagattctgaaacttggttgcagcaactgcttgtgggctcgctctttctgtaaaaaatggcctaactagtagtgctc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
63049 |
acatcctctcaagacatgttataaagattctgaaacttggttgcagcaactgcttgttggctcgctctttctgtaaaaaatggcctaactagtagtgctc |
62950 |
T |
 |
| Q |
101 |
aatttgctgtgaaactttgactgaaatggatgcttggtttctcgacatatttcaaataataagaggataatatgaacatcattctcaaactatcagtaag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
62949 |
aatttgctgtgaaactttgactgaaatggatgcttggtttctcgacatatttcaaataataagaggataatatgaacatcattctcaaactatcagtaag |
62850 |
T |
 |
| Q |
201 |
ttttgacattccctttg |
217 |
Q |
| |
|
|||||||||||| |||| |
|
|
| T |
62849 |
ttttgacattccatttg |
62833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 217
Target Start/End: Original strand, 21320750 - 21320966
Alignment:
| Q |
1 |
acatcctctcaagacatgttataaagattctgaaacttggttgcagcaactgcttgtgggctcgctctttctgtaaaaaatggcctaactagtagtgctc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21320750 |
acatcctctcaagacatgttataaagattctgaaacttggttgcagcaactgcttgttggctcgctctttctgtaaaaaatggcctaactagtagtgctc |
21320849 |
T |
 |
| Q |
101 |
aatttgctgtgaaactttgactgaaatggatgcttggtttctcgacatatttcaaataataagaggataatatgaacatcattctcaaactatcagtaag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21320850 |
aatttgctgtgaaactttgactgaaatggatgcttggtttctcgacatatttcaaataataagaggataatatgaacatcattctcaaactatcagtaag |
21320949 |
T |
 |
| Q |
201 |
ttttgacattccctttg |
217 |
Q |
| |
|
|||||||||||| |||| |
|
|
| T |
21320950 |
ttttgacattccatttg |
21320966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University