View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6298_high_7 (Length: 374)
Name: NF6298_high_7
Description: NF6298
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6298_high_7 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 76; Significance: 5e-35; HSPs: 4)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 76; E-Value: 5e-35
Query Start/End: Original strand, 220 - 335
Target Start/End: Original strand, 39509773 - 39509892
Alignment:
| Q |
220 |
tggcaatgagatgccaaagttaagannnnnnnnnatcgatgaaaattaaactacaacactcaaacatcatgacggagtggtatgtatca----taagatt |
315 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
39509773 |
tggcaatgagatgccaaagttaagattcttttttatcgatgaaaattaaactacaacactcaaacatcatgacggagtggtatgtatcaaaattaagatt |
39509872 |
T |
|
| Q |
316 |
aagacatgagagtaattttt |
335 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
39509873 |
aagacatgagagtaattttt |
39509892 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 60 - 142
Target Start/End: Original strand, 39509617 - 39509696
Alignment:
| Q |
60 |
aggatttgagactttcacaaacatgtttgtgaaaatggagcatctacaattactacatctcatcaaaataatgcaacgtgtgg |
142 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
39509617 |
aggatttgagactttcacaagcatgtttgtgaaaatggagcatctacaat---tacatctcatcaaaataatgcaacgtgtgg |
39509696 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 8 - 50
Target Start/End: Original strand, 39509538 - 39509580
Alignment:
| Q |
8 |
gagatgaatcagatcatgaatgaggattgtgaatgtgatacca |
50 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39509538 |
gagatgaatcagatcatgaatgaggattgtgaatgtgatacca |
39509580 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 331 - 359
Target Start/End: Original strand, 39509923 - 39509951
Alignment:
| Q |
331 |
ttttttatgaatcgactaccccactttat |
359 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
39509923 |
ttttttatgaatcgactaccccactttat |
39509951 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University