View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6298_high_8 (Length: 364)
Name: NF6298_high_8
Description: NF6298
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6298_high_8 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 312; Significance: 1e-176; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 312; E-Value: 1e-176
Query Start/End: Original strand, 12 - 355
Target Start/End: Original strand, 24563447 - 24563790
Alignment:
| Q |
12 |
aaatcaaagaaatcaaaaacggcatcatcatcttccatcacctcttcagcagcaaccacgccaacaccgcttcaaccggaagctgataagtcagattctc |
111 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24563447 |
aaatcaaagaaatcaaagacggcatcatcatcttccatcccctcttcagcagcaaccacgccaacaccgcttcaaccggaagctgataagtcagattctc |
24563546 |
T |
 |
| Q |
112 |
actccaacagtgatggctcaaccattagggttaactctgttatagaaaatgaacaagttaatagcttcaggaacctcataacatcaagttcaaccaatga |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
24563547 |
actccaacagtgatggctcaaccattagggttaactctgttatagaaaatgaacaagttaatagcttcaggaacctcataatatcaagttcaaccaatga |
24563646 |
T |
 |
| Q |
212 |
tcaagtacatgtggtacagcatggagactcggtgatgctaaaccatcagcagttcccaaatgagtttggatcgttggattgggaaggtggtgctaacacc |
311 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
24563647 |
tcaagtacatgtggtacagcatggagactcggtgatgctcaaccatcagcagttctcaaatgaatttggatcgttggattgggaaggtggtgctaacacc |
24563746 |
T |
 |
| Q |
312 |
gttgatcagtcttactggacacactctcattggtctgatgatgt |
355 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||| |||| |
|
|
| T |
24563747 |
gttgatcagtcttactggacacagtctcattggtctgatcatgt |
24563790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University