View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6298_low_11 (Length: 295)
Name: NF6298_low_11
Description: NF6298
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6298_low_11 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 272; Significance: 1e-152; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 272; E-Value: 1e-152
Query Start/End: Original strand, 3 - 278
Target Start/End: Original strand, 6650573 - 6650848
Alignment:
| Q |
3 |
cctgctgcggctcagcagcagatcttggaagctcaacaattggctgctgctgttgctgctagagagcaacaggaaatttttaggacttttgagaatcaac |
102 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6650573 |
cctgctgcggctcagcatcagatcttggaagctcaacaattggctgctgctgttgctgctagagagcaacaggaaatttttaggacttttgagaatcaac |
6650672 |
T |
 |
| Q |
103 |
aacagcagcaacagcaagagtttttaaggtttagtggtgggtttgatgtggattcagtttctaattcttctgctggtggtgggttcaaccaagtgtcccc |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6650673 |
aacagcagcaacagcaagagtttttaaggtttagtggtgggtttgatgtggattcagtttctaattcttctgctggtggtgggttcaaccaagtgtcccc |
6650772 |
T |
 |
| Q |
203 |
agtttctgctgttggtgttgctgctgatcaattgtctccttctttggctttgggatcttttgataatacttatcat |
278 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6650773 |
agtttctgctgttggtgttgctgctgatcaattgtctccttctttggctttgggatcttttgataatacttatcat |
6650848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University