View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6298_low_12 (Length: 287)
Name: NF6298_low_12
Description: NF6298
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6298_low_12 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 225; Significance: 1e-124; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 19 - 280
Target Start/End: Original strand, 14166745 - 14167006
Alignment:
| Q |
19 |
gaagctacggatggtggtatacaatgccttctgaaattcatcagatccttcatccaacagcttctgtaaagattaaacggacacaaatttaaataacgag |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14166745 |
gaagctacggatggtggtatacaatgccttctgaaattcatcagatccttcatccaacagcttctgtaaagattaaacggacacaaatttaaataacgaa |
14166844 |
T |
 |
| Q |
119 |
ttataatatcataannnnnnnaatatcgtaatctttttattatataccttagtgatggaagtaccatgagtctctctgtagcggttgaatgtcgcaatca |
218 |
Q |
| |
|
| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14166845 |
tcataatatcataatttttttaatatcgtaatctttttattatataccttagtgatggaagtaccatgagtctctctgtagcggttgaatgtcgcaatca |
14166944 |
T |
 |
| Q |
219 |
gctgggttttgctccttgtagtcaagatcctaatggcttcttcatgacttcctttcttctct |
280 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
14166945 |
gctgggttttgctccttgtagtcaagatccttatggcttcttcatggcttcctttcttctct |
14167006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 191 - 280
Target Start/End: Original strand, 14173880 - 14173969
Alignment:
| Q |
191 |
tctctgtagcggttgaatgtcgcaatcagctgggttttgctccttgtagtcaagatcctaatggcttcttcatgacttcctttcttctct |
280 |
Q |
| |
|
||||||||||||||||| || || | ||||| || |||||||||||||| | ||| |||||||||||||||||| ||||||| |||||| |
|
|
| T |
14173880 |
tctctgtagcggttgaaagttgccaaaagctgagtcttgctccttgtagtaaggattctaatggcttcttcatgatttccttttttctct |
14173969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University