View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6298_low_16 (Length: 274)
Name: NF6298_low_16
Description: NF6298
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6298_low_16 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 17 - 261
Target Start/End: Complemental strand, 33618694 - 33618450
Alignment:
| Q |
17 |
tgtctctgatgcatgatgggtgcactgccactccactcgaccatggaactagggaagcaatgaaatggtcaaagctcagaaaacatgtggaaatagaaga |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33618694 |
tgtctctgatgcatgatgggtgcactgccactccactcgaccatggaactagggaagcaatgaaatggtcaaagctcagaaaacatgtggaaatagaaga |
33618595 |
T |
 |
| Q |
117 |
ccaaaggatctcaaacttcgcattgtattattctcttaccattggttgatgcaacattgaattaggacctctcacataaatttctaaatcactagcttta |
216 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33618594 |
ccaaacgatctcaaacttcgcattgtattattctcttaccattggttgatgcaacattgaattaggacctctcacataaatttctaaatcactagcttta |
33618495 |
T |
 |
| Q |
217 |
aaactcccacaattcatcaacctcaacactactacattctcgttc |
261 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33618494 |
aaactcccacaattcatcaacctcaacactactacattctcgttc |
33618450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University