View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6298_low_18 (Length: 259)
Name: NF6298_low_18
Description: NF6298
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6298_low_18 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 167; Significance: 2e-89; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 1 - 184
Target Start/End: Complemental strand, 43255488 - 43255301
Alignment:
| Q |
1 |
tgtaagaaatgacatttacaagaactagaataattcagcatctttgtgtgttaacttctttgttgcaccccttccttaatggaagttttccctttctcat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43255488 |
tgtaagaaatgacatttacaagaactagaataattcagcatctttgtgtgttaacttctttgttgcaccccttccttaatggaagttttccctttctcat |
43255389 |
T |
|
| Q |
101 |
gaaaggttccttttgttacttgcttgcccatcccaatccaaattccatcctccttacc----atgtcaccaccatcacatcttttgct |
184 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
43255388 |
gaaaggttccttttgttacttgcttgcccctcccaatccaaattccatcctccttaccatatatgtcaccaccatcacatcttttgct |
43255301 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 1 - 67
Target Start/End: Complemental strand, 43258754 - 43258688
Alignment:
| Q |
1 |
tgtaagaaatgacatttacaagaactagaataattcagcatctttgtgtgttaacttctttgttgca |
67 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
43258754 |
tgtaagaaatgacatttacaagaactagaaatattcagcatctttgtgtgttaacttctttgttgca |
43258688 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 207 - 245
Target Start/End: Complemental strand, 43255294 - 43255256
Alignment:
| Q |
207 |
acctcttcatttacatgatctttctcttttgctcgaaac |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43255294 |
acctcttcatttacatgatctttctcttttgctcgaaac |
43255256 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 5 - 67
Target Start/End: Complemental strand, 43226066 - 43226006
Alignment:
| Q |
5 |
agaaatgacatttacaagaactagaataattcagcatctttgtgtgttaacttctttgttgca |
67 |
Q |
| |
|
||||||||||| |||||||||||||| |||| | |||| |||||||||||||||||||||| |
|
|
| T |
43226066 |
agaaatgacatgtacaagaactagaaatattcggtatct--gtgtgttaacttctttgttgca |
43226006 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University