View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6298_low_25 (Length: 227)
Name: NF6298_low_25
Description: NF6298
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6298_low_25 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 7 - 227
Target Start/End: Complemental strand, 47872035 - 47871807
Alignment:
| Q |
7 |
gcaagttgcttgagatcaaagtcaac--------agtgatttgttttgatttctcaaggatcagaaagagacttccactatatataatttggagaaccag |
98 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47872035 |
gcaagttgcttgagatcaaagtcaactttggatcagtgatttgttttgatttctcaaggatcagaaagagacttccactatatataatttggagaaccag |
47871936 |
T |
 |
| Q |
99 |
aaactccgcattaaccatttggtaagaatttcaatgttacaaattatatatgataatgaaaatcaatgaaaagttgaaagaatgggttnnnnnnncacca |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
47871935 |
aaactccgcattaaccatttggtaagaatttcaatgttacaaattatatatgatattgaaaatcaatgaaaagttgaaagaatgggttaaaaaaacacca |
47871836 |
T |
 |
| Q |
199 |
gctggtaggacataattcaattagaagaa |
227 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
47871835 |
gctggtaggacataattcaattagaagaa |
47871807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University