View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6298_low_29 (Length: 215)

Name: NF6298_low_29
Description: NF6298
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6298_low_29
NF6298_low_29
[»] chr7 (1 HSPs)
chr7 (1-200)||(5360846-5361045)


Alignment Details
Target: chr7 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 1 - 200
Target Start/End: Complemental strand, 5361045 - 5360846
Alignment:
1 gtggagggaataatggaggaaaaggaaaagccaatcctggtggtgacgaaggtggcggtgaaggacttaaacctggtaccgacggaaaaggaaacaatgg 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5361045 gtggagggaataatggaggaaaaggaaaagccaatcctggtggtgacgaaggtggcggtgaaggacttaaacctggtaccgacggaaaaggaaacaatgg 5360946  T
101 tgatgaccctgatggaggtggctgaaatggattattggggactaatggtgttggagttggtggttgaaatgggttaggaatagttggtgtacttggtggt 200  Q
    |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5360945 tgatgaccctgatggaggtggcagaaatggattattggggactaatggtgttggagttggtggttgaaatgggttaggaatagttggtgtacttggtggt 5360846  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University