View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6298_low_6 (Length: 400)
Name: NF6298_low_6
Description: NF6298
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6298_low_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 373; Significance: 0; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 373; E-Value: 0
Query Start/End: Original strand, 18 - 398
Target Start/End: Original strand, 45929961 - 45930341
Alignment:
| Q |
18 |
aaatccctatattgatttattgttttcaggaatgggttacggatagtccattcattatatcacctagaattacttttgaggtcagtgtgcgtcttcttgg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45929961 |
aaatccctatattgatttattgttttcaggaatgggttacggatagtccattcattatatcacctagaattacttttgaggtcagtgtgcgtcttcttgg |
45930060 |
T |
 |
| Q |
118 |
agggctgatggccttggggtatacaattgcagcaatcctgaaaagaagcagccatgtctttcacgatgataaagtatccataaaaactgactggcttgaa |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
45930061 |
agggctgatggccttggggtatacaattgcagcaatcctgaaaagaagcagccatgtctttcacgatgataaagtatccataaaaactgactggctcgaa |
45930160 |
T |
 |
| Q |
218 |
cagcttaatcgccaatatgtccaggtacaacagcatattgtttgtatctctcccttcttacttttttctatgcttaatcgtcaatattgtctggtacaaa |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45930161 |
cagcttaatcgccaatatgtccaggtacaacagcatattgtttgtatctctcccttcttacttttttctatgcttaatcgtcaatattgtctggtacaaa |
45930260 |
T |
 |
| Q |
318 |
agaaattccaatactagcttgaccctcacaacccgctcttttccctctattcttttgttgagtgttgtcttccattcatat |
398 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45930261 |
agaaattccaatactagctcgaccctcacaacccgctcttttccctctattcttttgttgagtgttgtcttccattcatat |
45930341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 40 - 178
Target Start/End: Original strand, 28076100 - 28076238
Alignment:
| Q |
40 |
ttttcaggaatgggttacggatagtccattcattatatcacctagaattacttttgaggtcagtgtgcgtcttcttggagggctgatggccttggggtat |
139 |
Q |
| |
|
||||||||||||||| || |||||||| || | |||||||| |||||||||||||||||||||||||| || ||||| || || ||||||||||| ||| |
|
|
| T |
28076100 |
ttttcaggaatgggtgacagatagtccctttgtcatatcaccgagaattacttttgaggtcagtgtgcgcctccttggtggactaatggccttgggatat |
28076199 |
T |
 |
| Q |
140 |
acaattgcagcaatcctgaaaagaagcagccatgtcttt |
178 |
Q |
| |
|
|| || || | ||||| || |||| ||| ||||||||| |
|
|
| T |
28076200 |
acgatagctactatccttaagagaaacagtcatgtcttt |
28076238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 48; Significance: 3e-18; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 74 - 177
Target Start/End: Original strand, 29536842 - 29536945
Alignment:
| Q |
74 |
atatcacctagaattacttttgaggtcagtgtgcgtcttcttggagggctgatggccttggggtatacaattgcagcaatcctgaaaagaagcagccatg |
173 |
Q |
| |
|
|||||||| ||||||||||||| ||||||||||||||||||||| || ||||||||| | || || ||||| ||| | || || |||||||| ||||||| |
|
|
| T |
29536842 |
atatcaccgagaattacttttgcggtcagtgtgcgtcttcttggtggactgatggcccttggatacacaatagcaactattcttaaaagaagtagccatg |
29536941 |
T |
 |
| Q |
174 |
tctt |
177 |
Q |
| |
|
|||| |
|
|
| T |
29536942 |
tctt |
29536945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University