View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6301_low_21 (Length: 255)
Name: NF6301_low_21
Description: NF6301
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6301_low_21 |
 | |
|
| [»] scaffold0021 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0021 (Bit Score: 86; Significance: 3e-41; HSPs: 1)
Name: scaffold0021
Description:
Target: scaffold0021; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 5 - 122
Target Start/End: Original strand, 161940 - 162057
Alignment:
| Q |
5 |
ttccctttactctcatctcttcttctggacacattcaagaattcctcactactatccacttttaaatttttaaagttagttaactcattggtcttaagag |
104 |
Q |
| |
|
||||||||||||| | |||||||||| |||||||||||||||||| || |||||||||||| |||||||||||||||||||||||||||||| |||||| |
|
|
| T |
161940 |
ttccctttactctgacctcttcttcttgacacattcaagaattccatacaactatccactttcaaatttttaaagttagttaactcattggtcctaagag |
162039 |
T |
|
| Q |
105 |
ccgattggacatcatcca |
122 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
162040 |
ccgattggacatcatcca |
162057 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University