View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6302_high_22 (Length: 244)
Name: NF6302_high_22
Description: NF6302
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6302_high_22 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 1 - 231
Target Start/End: Original strand, 50193245 - 50193464
Alignment:
| Q |
1 |
cggcgaccttgtagcggttacggcgagcatcggccttggaatcgggcttagaatcgttcttggaatcgttgttggaattaggtcgaagcggcatcgtttc |
100 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
50193245 |
cggcgaccttgtagcgattacggcgagcatcggccttggaatcgggcttagaatcgttcttggaat------------taggtcgaagcggcatcgtttc |
50193332 |
T |
 |
| Q |
101 |
ggttgttgatgatcaaa-aaacgagagaagaatttgaatgtaaccgcgaaagaaaggaattttgctctcccatgcacttttcgctcacaccttatagcca |
199 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||| | ||| |||| |
|
|
| T |
50193333 |
ggttgttgatgatcaaagaaacgagagaagaatttgaatgtaaccgcgaaagaaaggaattctgctctcccctgcacttttcgctcacatcctatggcca |
50193432 |
T |
 |
| Q |
200 |
tgacgaaaaagcccatgggtgacttaagtcac |
231 |
Q |
| |
|
|||||||||||||| || || ||||||||||| |
|
|
| T |
50193433 |
tgacgaaaaagcccgtgcgtcacttaagtcac |
50193464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University