View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6302_high_25 (Length: 240)
Name: NF6302_high_25
Description: NF6302
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6302_high_25 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 84; Significance: 5e-40; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 135 - 222
Target Start/End: Complemental strand, 29850141 - 29850054
Alignment:
| Q |
135 |
gaacctttaaatgattttctatgctatggaaagataaattaaataactttaaattcaagacccttaaataattaattgaagggctatc |
222 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29850141 |
gaacctttaaatgattttctatgctatagaaagataaattaaataactttaaattcaagacccttaaataattaattgaagggctatc |
29850054 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 1 - 83
Target Start/End: Complemental strand, 29850274 - 29850192
Alignment:
| Q |
1 |
ataaaataacataacaaagaaacccaaaataattattaaaaatgaaacaagatatgtatccatctgtttttgtactatatttc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29850274 |
ataaaataacataacaaagaaacccaaaataattattaaaaatgaaacaagatatgtatccatctgtttttgtactatatttc |
29850192 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University