View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6302_high_4 (Length: 386)
Name: NF6302_high_4
Description: NF6302
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6302_high_4 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 140; Significance: 3e-73; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 140; E-Value: 3e-73
Query Start/End: Original strand, 29 - 180
Target Start/End: Complemental strand, 31186214 - 31186063
Alignment:
| Q |
29 |
ataaacctaatttccagattctaacatcatttgcctttaaaaatatcaatgctttgttgcatgagccagcttcctttttccaaaggccactgttgatcac |
128 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||| ||||||||| |
|
|
| T |
31186214 |
ataaacctaatttccagattctaacatcatttgcctttaaaaaaatcaatgctttgttgcatgcgccagcttcctttttccaaaggccaccgttgatcac |
31186115 |
T |
 |
| Q |
129 |
cgcgtataaaagtaaaaagatgatttacatggcaattacatgattttagtgg |
180 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31186114 |
cgcgtataaaagtaaaaagatgatttacatggcaattacatgattttagtgg |
31186063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 180 - 219
Target Start/End: Complemental strand, 31186035 - 31185996
Alignment:
| Q |
180 |
gtagggtctcctttatgtcgggcctgttgaaaatgtcatc |
219 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
31186035 |
gtagggtctactttatgtcgggcctgttgaaaatgtcatc |
31185996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 180 - 219
Target Start/End: Complemental strand, 31207128 - 31207089
Alignment:
| Q |
180 |
gtagggtctcctttatgtcgggcctgttgaaaatgtcatc |
219 |
Q |
| |
|
|||||||||||||||||| |||||| |||||||||||||| |
|
|
| T |
31207128 |
gtagggtctcctttatgttgggcctattgaaaatgtcatc |
31207089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University