View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6302_high_8 (Length: 294)
Name: NF6302_high_8
Description: NF6302
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6302_high_8 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 272; Significance: 1e-152; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 272; E-Value: 1e-152
Query Start/End: Original strand, 1 - 284
Target Start/End: Complemental strand, 8585130 - 8584847
Alignment:
| Q |
1 |
tgaagcaagcgagactggtcatgcacaatccaaagctggagcattagcagctgagctagaagaaacaaagcaaaaacttgaaggatcaaaagaagaagct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8585130 |
tgaagcaagcgagactggtcatgcacaatccaaagctggagcattagcagctgagctagaagaaacaaagcaaaaacttgaaggatcaaaagaagaagct |
8585031 |
T |
|
| Q |
101 |
aacttcttagcacaatgcatcaaatccctcaagaaagaacttgagcaaacaaagaaagaattggaagaaacaaaggcaagagagttgaagttgcttcaac |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
8585030 |
aacttcttagcacaatgcatcaaatccctcaagaaagaacttgagcaaacaaagaaagaattggaagaaacaaaggcaagagagtggaagttgcttcaac |
8584931 |
T |
|
| Q |
201 |
gacgtgatattccagagacaaacgaagacatcaagttcatcgcgaacggaaccaatgtggaaatcaaaacccaaaatgatgatg |
284 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
8584930 |
gacgtgatattccagagacaaacgaagacatcaagttcattgcgaacggaaccaatgtggaaatcaaaacacaaaatgatgatg |
8584847 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University