View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6302_low_18 (Length: 258)
Name: NF6302_low_18
Description: NF6302
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6302_low_18 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 246
Target Start/End: Original strand, 29850283 - 29850528
Alignment:
| Q |
1 |
taacttttcatatgctgtattttgtaaaaataatgaataaagatgaattgctgaataatct-gtcagttttgtccccaccttctatatcatcatatggag |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
29850283 |
taacttttcatatgctgtattttgtaaaaataatgaataaagatgaattgctgaataatcttgtcagttttgtccccaccttctatgtcatcatatggag |
29850382 |
T |
|
| Q |
100 |
ggttgccaatgtgttgctttgtttgtgtgcatctttcccttttttaataccattattnnnnnnnnntattgtaccatattgcttttaattttgggatcct |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
29850383 |
ggttgccaatgtgttgctttgtttgtgtgcatctttcccttttttaataccattatt-aaaaaaaatattgtaccatattgcttttaattttgggatcct |
29850481 |
T |
|
| Q |
200 |
tattcctcaataaattttgatgaaagcatcctcttttcttttgtttc |
246 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29850482 |
tattcctcaataaattttgatgaaagcatcctcttttcttttgtttc |
29850528 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University