View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6302_low_29 (Length: 238)
Name: NF6302_low_29
Description: NF6302
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6302_low_29 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 137; Significance: 1e-71; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 1 - 141
Target Start/End: Original strand, 44625289 - 44625429
Alignment:
| Q |
1 |
tatgttttattgtagagttcaattgctttaccattgtccctctatgctagtattttaattacttcaaattctgcagtaaagaatattgataatagttacg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44625289 |
tatgttttattgtagagttcaattgctttaccattgtccctctatgcaagtattttaattacttcaaattctgcagtaaagaatattgataatagttacg |
44625388 |
T |
 |
| Q |
101 |
atcaactgttttaccattgaaatgtgtccaagaattatact |
141 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44625389 |
atcaactgttttaccattgaaatgtgtccaagaattatact |
44625429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 88
Target Start/End: Original strand, 44652408 - 44652495
Alignment:
| Q |
1 |
tatgttttattgtagagttcaattgctttaccattgtccctctatgctagtattttaattacttcaaattctgcagtaaagaatattg |
88 |
Q |
| |
|
||||||||||||| |||| |||||| ||||| ||||||||||| |||||| |||| |||| ||||||||||| | |||||||||| |
|
|
| T |
44652408 |
tatgttttattgtcgagtccaattgttttacgattgtccctcttagctagtgttttctttacatcaaattctgccatgaagaatattg |
44652495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 88
Target Start/End: Original strand, 44681324 - 44681411
Alignment:
| Q |
1 |
tatgttttattgtagagttcaattgctttaccattgtccctctatgctagtattttaattacttcaaattctgcagtaaagaatattg |
88 |
Q |
| |
|
||||||| ||||| |||| |||||| ||||| ||||||||||| |||||| |||| |||| ||||||||||| | |||||||||| |
|
|
| T |
44681324 |
tatgtttgattgtcgagtccaattgttttacgattgtccctcttagctagtgttttctttacatcaaattctgccatgaagaatattg |
44681411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University