View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6302_low_31 (Length: 231)
Name: NF6302_low_31
Description: NF6302
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6302_low_31 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 146; Significance: 5e-77; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 50 - 199
Target Start/End: Complemental strand, 32267001 - 32266852
Alignment:
| Q |
50 |
aaccacattggaacaaaatgaaatgatcaaattctgcaaagaacgtgggaaaggttttccttcattgaaagcactttgtggacacatggcttctcattct |
149 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32267001 |
aaccacattggaacaaaatgaaatgatcaaattctgcaaagaatgtgggaaaggttttccttcattgaaagcactttgtggacacatggcttctcattct |
32266902 |
T |
 |
| Q |
150 |
gagaaagagaaaaagatcaacaaggctatgatggaggaggatactcaatc |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32266901 |
gagaaagagaaaaagatcaacaaggctatgatggaggaggatactcaatc |
32266852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 52; Significance: 6e-21; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 78 - 157
Target Start/End: Complemental strand, 19301476 - 19301397
Alignment:
| Q |
78 |
aaattctgcaaagaacgtgggaaaggttttccttcattgaaagcactttgtggacacatggcttctcattctgagaaaga |
157 |
Q |
| |
|
||||||||||||||| |||| ||||||||||| |||||||||||||| ||||| |||||||||| ||| ||||||||||| |
|
|
| T |
19301476 |
aaattctgcaaagaatgtggaaaaggttttccatcattgaaagcactgtgtggtcacatggcttgtcactctgagaaaga |
19301397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University