View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6302_low_33 (Length: 206)
Name: NF6302_low_33
Description: NF6302
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6302_low_33 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 164; Significance: 7e-88; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 164; E-Value: 7e-88
Query Start/End: Original strand, 26 - 189
Target Start/End: Complemental strand, 1751664 - 1751501
Alignment:
| Q |
26 |
cacagacaaacacacaatctttggttacaagccatttcaaaaatgggaaatccgccatacaaagcagtgaatctaggaaactggcttttggctgaggggt |
125 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1751664 |
cacagacaaacacacaatctttggttacaagccatttcaaaaatgggaaatccgccatacaaagcagtgaatctaggaaactggcttttggctgaggggt |
1751565 |
T |
 |
| Q |
126 |
ggatgaaaccttctctctttgaaggaattgtcaacaaagatctcttggtatcactccctcaatt |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1751564 |
ggatgaaaccttctctctttgaaggaattgtcaacaaagatctcttggtatcactccctcaatt |
1751501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 87; E-Value: 7e-42
Query Start/End: Original strand, 73 - 175
Target Start/End: Complemental strand, 1759658 - 1759556
Alignment:
| Q |
73 |
aaatccgccatacaaagcagtgaatctaggaaactggcttttggctgaggggtggatgaaaccttctctctttgaaggaattgtcaacaaagatctcttg |
172 |
Q |
| |
|
|||||| ||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
1759658 |
aaatccaccatacaaagctgtgaatctaggaaactggctcttggctgaggggtggatgaaaccttctctctttgaaggaattgtcaacaaagatctattg |
1759559 |
T |
 |
| Q |
173 |
gta |
175 |
Q |
| |
|
||| |
|
|
| T |
1759558 |
gta |
1759556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 57; E-Value: 5e-24
Query Start/End: Original strand, 83 - 183
Target Start/End: Complemental strand, 1722199 - 1722099
Alignment:
| Q |
83 |
tacaaagcagtgaatctaggaaactggcttttggctgaggggtggatgaaaccttctctctttgaaggaattgtcaacaaagatctcttggtatcactcc |
182 |
Q |
| |
|
|||||||| |||||||| |||||||||||| | ||||| || |||||| |||| |||| |||||| |||||||||||||||||||||||||||||| ||| |
|
|
| T |
1722199 |
tacaaagctgtgaatcttggaaactggcttgttgctgaaggatggatggaaccatctcgctttgacggaattgtcaacaaagatctcttggtatcattcc |
1722100 |
T |
 |
| Q |
183 |
c |
183 |
Q |
| |
|
| |
|
|
| T |
1722099 |
c |
1722099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 83 - 176
Target Start/End: Complemental strand, 1744308 - 1744215
Alignment:
| Q |
83 |
tacaaagcagtgaatctaggaaactggcttttggctgaggggtggatgaaaccttctctctttgaaggaattgtcaacaaagatctcttggtat |
176 |
Q |
| |
|
|||||||| |||||| |||||||||||||| | ||||| || |||||| |||| |||| |||||| |||||||||||||||||||||||||||| |
|
|
| T |
1744308 |
tacaaagctgtgaatttaggaaactggcttgttgctgaaggatggatggaaccatctcgctttgacggaattgtcaacaaagatctcttggtat |
1744215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University