View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6303_low_4 (Length: 272)
Name: NF6303_low_4
Description: NF6303
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6303_low_4 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 54 - 258
Target Start/End: Complemental strand, 31017655 - 31017451
Alignment:
| Q |
54 |
cttactgtcttctgatctcacttgattggtgctgcatcgtttgtaatagatttgtggaaagtcaccttttgcaacaaattgaatttaagaaaatacttgt |
153 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31017655 |
cttactgtcttctgatctcacttgattggtgctgcatcgtttgtaatagatttgtggaaagtcaccttttgcaacaaattgaatttaagaaaatacttgt |
31017556 |
T |
 |
| Q |
154 |
gtttacaagaaacaaaaaatagtggtagtattcactatagctaaactttgtttcaagtgactaaattcatttatgtatgtctgacagaaaatgagtcggc |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31017555 |
gtttacaagaaacaaaaaatagtggtagtattcactatagctaaactttgtttcaagtgactaaattcatttatgtatgtctgacagaaaatgagtcggc |
31017456 |
T |
 |
| Q |
254 |
ctttg |
258 |
Q |
| |
|
||||| |
|
|
| T |
31017455 |
ctttg |
31017451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University