View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6303_low_6 (Length: 255)
Name: NF6303_low_6
Description: NF6303
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6303_low_6 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 169; Significance: 1e-90; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 77 - 245
Target Start/End: Complemental strand, 41179149 - 41178981
Alignment:
| Q |
77 |
gtgacagtatcattagattggaattggactagtttttgagttttgtgtttggtgtgtcctgcagcttggaaatttcattcactacatggctacttttgtt |
176 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41179149 |
gtgacagtatcattagattggaattggactagtttttgagttttgtgtttggtgtgtcctgcagcttggaaatttcattcactacatggctacttttgtt |
41179050 |
T |
 |
| Q |
177 |
tctggttttgttgttggattcactgctgtttggcaattggctttggttacccttgctgttgttcctatg |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41179049 |
tctggttttgttgttggattcactgctgtttggcaattggctttggttacccttgctgttgttcctatg |
41178981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 1 - 57
Target Start/End: Complemental strand, 41179230 - 41179174
Alignment:
| Q |
1 |
tgttatggttcaggatgccattagtgagaaggttagatgaatgaacaagtgttaatg |
57 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41179230 |
tgttatggttcaggatgccattagtgagaaggttagatgaatgaacaagtgttaatg |
41179174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 56; Significance: 3e-23; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 154 - 245
Target Start/End: Original strand, 27806636 - 27806727
Alignment:
| Q |
154 |
ttcactacatggctacttttgtttctggttttgttgttggattcactgctgtttggcaattggctttggttacccttgctgttgttcctatg |
245 |
Q |
| |
|
||||||| |||||||| ||||||||||| |||| |||||| |||||||||||||||||||| || |||||||| |||||||| ||||||||| |
|
|
| T |
27806636 |
ttcactatatggctacatttgtttctggatttgctgttggtttcactgctgtttggcaattagcattggttacacttgctgtggttcctatg |
27806727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University