View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6303_low_7 (Length: 240)
Name: NF6303_low_7
Description: NF6303
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6303_low_7 |
 | |
|
| [»] chr7 (2 HSPs) |
| |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 104; Significance: 6e-52; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 137 - 240
Target Start/End: Complemental strand, 41179409 - 41179306
Alignment:
| Q |
137 |
atggattattgaaagagggttgtatttgttgcagagatttcttgttggatgtggactggagagcgacaatcaaccaagatgaggatcaagtatctggaag |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41179409 |
atggattattgaaagagggttgtatttgttgcagagatttcttgttggatgtggactggagagcgacaatcaaccaagatgaggatcaagtatctggaag |
41179310 |
T |
|
| Q |
237 |
ctgc |
240 |
Q |
| |
|
|||| |
|
|
| T |
41179309 |
ctgc |
41179306 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 19 - 51
Target Start/End: Complemental strand, 41179542 - 41179510
Alignment:
| Q |
19 |
gctatttgggcttcttcttgggcaggttagttg |
51 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
41179542 |
gctatttgggcttcttcttgggcaggttagttg |
41179510 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 56; Significance: 2e-23; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 161 - 240
Target Start/End: Original strand, 27806314 - 27806393
Alignment:
| Q |
161 |
tttgttgcagagatttcttgttggatgtggactggagagcgacaatcaaccaagatgaggatcaagtatctggaagctgc |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||| |||||||||| |||||||| || |||||||| |||||||| |
|
|
| T |
27806314 |
tttgttgcagagatttcttgttggatgtggactggtgagagacaatcaacaaagatgagaattaagtatcttgaagctgc |
27806393 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University