View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6304_high_25 (Length: 241)
Name: NF6304_high_25
Description: NF6304
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6304_high_25 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 19 - 241
Target Start/End: Original strand, 2357866 - 2358086
Alignment:
| Q |
19 |
tgcttgttgtaactatttgtttggatacatgatttttcttacttttttctcgaggatccatttaaacttcatatgaaaaattataagctttcataataga |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2357866 |
tgcttgttgtaactatttgtttggatacatgatttttcttacttttttctcgaggatccatttaaacttcatatgaaaaattataagctttcataataga |
2357965 |
T |
|
| Q |
119 |
ttgaatgaatgaaaatatcatgcaagagagttaaattaagtgagagagagagtnnnnnnnnaggaggctacaaagaattggagaaagagtgaggatgcaa |
218 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2357966 |
ttgaatgaatgaaaatatcatgtaagagagttaaattaagtgagagagaga--tgggggggaggaggctacaaagaattggagaaagagtgaggatgcaa |
2358063 |
T |
|
| Q |
219 |
aataaaattgcggggaaaaaatt |
241 |
Q |
| |
|
||||||||| |||||| |||||| |
|
|
| T |
2358064 |
aataaaattacggggacaaaatt |
2358086 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University