View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6304_high_27 (Length: 238)

Name: NF6304_high_27
Description: NF6304
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6304_high_27
NF6304_high_27
[»] chr2 (1 HSPs)
chr2 (18-221)||(37052577-37052780)


Alignment Details
Target: chr2 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 18 - 221
Target Start/End: Original strand, 37052577 - 37052780
Alignment:
18 aagaaggtagaggattgtaatgaagagcaaaaacaagtgatgggtggaaaacttgatgaggagaaacaaaatgggaatggtggagttttggttccgagac 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37052577 aagaaggtagaggattgtaatgaagagcaaaaacaagtgatgggtggaaaacttgatgaggagaaacaaaatgggaatggtggagttttggttccgagac 37052676  T
118 aatttatggagcttggattgcctgctaatcattctgatgctattgatgaaccaagaagtcaagatcagtcaaaatcacttgcaaacaacaatgaggaagg 217  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37052677 aatttatggagcttggattgcctgctaatcattctgatgctattgatgaaccaagaagtcaagatcagtcaaaatcacttgcaaacaacaatgaggaagg 37052776  T
218 ttcc 221  Q
    ||||    
37052777 ttcc 37052780  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University