View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6304_high_27 (Length: 238)
Name: NF6304_high_27
Description: NF6304
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6304_high_27 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 18 - 221
Target Start/End: Original strand, 37052577 - 37052780
Alignment:
| Q |
18 |
aagaaggtagaggattgtaatgaagagcaaaaacaagtgatgggtggaaaacttgatgaggagaaacaaaatgggaatggtggagttttggttccgagac |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37052577 |
aagaaggtagaggattgtaatgaagagcaaaaacaagtgatgggtggaaaacttgatgaggagaaacaaaatgggaatggtggagttttggttccgagac |
37052676 |
T |
|
| Q |
118 |
aatttatggagcttggattgcctgctaatcattctgatgctattgatgaaccaagaagtcaagatcagtcaaaatcacttgcaaacaacaatgaggaagg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37052677 |
aatttatggagcttggattgcctgctaatcattctgatgctattgatgaaccaagaagtcaagatcagtcaaaatcacttgcaaacaacaatgaggaagg |
37052776 |
T |
|
| Q |
218 |
ttcc |
221 |
Q |
| |
|
|||| |
|
|
| T |
37052777 |
ttcc |
37052780 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University