View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6304_low_20 (Length: 252)
Name: NF6304_low_20
Description: NF6304
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6304_low_20 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 18 - 239
Target Start/End: Complemental strand, 25794832 - 25794611
Alignment:
| Q |
18 |
ttaagtacccagcttaattgaggatgtaaacatctagatacatttatatgcaaaggtgttataagatatgtaaggtgtggtgtattaccaattctagtat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25794832 |
ttaagtacccagcttaattgaggatgtaaacatctagatacatttatatgcaaaggtgttataagatatgtaaggtgtggtgtattaccaattctagtat |
25794733 |
T |
|
| Q |
118 |
gacaccggacttttctatttgggccctataccacgtgagctctaggttgtataaagtgaaattctttctcctagcccccacacacacgcacgcgcacgca |
217 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| || |||||||||| |
|
|
| T |
25794732 |
gacactggacttttctatttgggccctataccacgtgagctctaggttgtataaagtgaaattctttctcctaccccccacacacatgcgcgcgcacgca |
25794633 |
T |
|
| Q |
218 |
ccaaacacctctctcgcaccct |
239 |
Q |
| |
|
||||| |||||||||||||||| |
|
|
| T |
25794632 |
ccaaaaacctctctcgcaccct |
25794611 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University